Review



nbp2 29542 plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Addgene inc nbp2 29542 plasmid
    Nbp2 29542 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nbp2+29542+plasmid/pCDF1-ERBB4+(E836K)+(Plasmid+%2329542)/pm38100351-247-90-102
    Average 91 stars, based on 5 article reviews
    nbp2 29542 plasmid - by Bioz Stars, 2026-09
    91/100 stars

    Images

    Related Articles

    Knock-Out:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Recombinant:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Plasmid Preparation:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Expressing:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Mutagenesis:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    shRNA:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Negative Control:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Real-time Polymerase Chain Reaction:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710

    Software:

    Article Title: Reprogramming of tumor-associated macrophages via NEDD4-mediated CSF1R degradation by targeting USP18.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Usp18f/f Arimoto et al.19 N/A Mouse: Isg15 knockout Osiak et al.82 N/A Oligonucleotides Primer: mouse Gapdh Forward: TATGTCGTGGAGTCTACTGG This paper N/A Primer: mouse Gapdh Reverse: GAGTTGTCATATTTCTCGTG This paper N/A Primer: mouse Usp18 Forward: CAGCCCTCATGGTCTGGTTG This paper N/A Primer: mouse Usp18 Reverse: GCACTCCGAGGCACTGTTAT This paper N/A Primer: mouse Csf1r Forward: AATGCTAACGCCACCGAGA This paper N/A Primer: mouse Csf1r Reverse: CATGGAAAGTTCGGACACAGG This paper N/A Primer: mouse Nedd4 Forward: ACCAGCGTGCAGACAAAAAC This paper N/A Primer: mouse Nedd4 Reverse: AAAAGAATGCGGTGTCGCTG This paper N/A Recombinant DNA Plasmid: pCL-10A1 Novus Cat #: NBP2-29542 Plasmid: pCL-Eco Novus Cat #: NBP2-29540 Plasmid: psPAX2 Dr. Didier Trono (Addgene) RRID: Addgene_12260 Plasmid: pMD2.G Dr. Didier Trono (Addgene) RRID: Addgene_12259 Plasmid: pCX4-bsr Dr. Tsuyoshi Akagi (KAN Research Institute) N/A Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat #: V79020 Plasmid: pCX4-bsr-mouse Usp18 This paper N/A Plasmid: pCX4-bsr -FLAG-mouse Usp18 This paper N/A Plasmid: pCX4-bsr-human USP18 (sgRNA resistant) This paper N/A Plasmid: pCX4-bsr-human USP18 C64S (sgRNA resistant) This paper N/A Plasmid: pCAG-mouse Csf1r-FLAG This paper N/A Plasmid: pCAG-human CSF1R-FLAG This paper N/A Plasmid: pcDNA-Myc-human NEDD4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (C744A mutant) This paper N/A Plasmid: pcDNA -HA-mouse Nedd4 (HECT domain deletion mutant) This paper N/A Plasmid: pcDNA-FLAG-mouse Nedd4 This paper N/A Plasmid: pcDNA-Myc-Ubiquitin This paper N/A Plasmid: pEGFP-N1 Clontech Cat #: 6085-1 Plasmid: pSUPER.retro.puro OligoEngine Cat #: VEC-PRT-0002 Plasmid: pSUPER.retro.puro-human USP18 shRNA This paper N/A Plasmid: pLKO.1 Negative control (GFP) This paper N/A Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038791 Plasmid: pLKO.1-human UBCH5C shRNA La Jolla Institute for Immunology Cat #: TRCN0000038793 Plasmid: pLKO.1-mouse Nedd4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000092436 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007550 Plasmid: pLKO.1-human NEDD4 shRNA La Jolla Institute for Immunology Cat #: TRCN0000007551 (Continued on next page) 20 Cell Reports 42, 113560, December 26, 2023

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data RNAseq data of cell lines This paper GEO: GSE226754 RNAseq data of HPV-positive OPSCCs from Johns Hopkins University cohort Guo et al.21 GEO: GSE112027 Experimental models: Cell lines Human: CAL-27 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_1107 Human: HEK293T Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_0063 Mouse: DC2.4 Dr. Dong-Er Zhang (University of California, San Diego) RRID: CVCL_J409 Mouse: MOC2 Dr. J. Silvio Gutkind (University of California, San Diego) RRID: CVCL_ZD33 Mouse: AT-84 Dr. Aldo Venuti (Regina Elena National Cancer Institute, Italy) N/A Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Strain#: 000664; RRID: IMSR_JAX:000664 Mouse: C3H/HeNCrl Charles River Laboratories Strain Code: 025; RRID: IMSR_CRL:025 Oligonucleotides See Table S5 for qPCR primers This paper N/A Recombinant DNA Plasmid: pLXSN-AU1-HPV16 E5 (codonoptimized) Dr. Frank Suprynowicz (Georgetown University Medical School) N/A Plasmid: MIP (MSCV-IRES-Puro) Dr. Dong-Er Zhang (University of California, San Diego) N/A Plasmid: pMSCV-Blasticidin Addgene Plasmid: #75085; RRID: Addgene_75085 Plasmid: pMSCV-Zeo Addgene Plasmid: #75088; RRID: Addgene_75088 Plasmid: pCL-10A1 Novus Cat#: NBP2-29542 Plasmid: pCL-Eco Novus Cat#: NBP2-29540 Plasmid: pcDNATM3.1 (+) Mammalian Expression Vector Thermo Fisher Scientific (Invitrogen) Cat#: V79020 Plasmid: MIP-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pMSCV-Blasticidin-HPV16 E6 This paper N/A Plasmid: pMSCV-Zeo-HPV16 E7 This paper N/A Plasmid: pcDNA-FLAG-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-HPV16 E5 (codonoptimized) This paper N/A Plasmid: pcDNA-HA-human MAVS This paper N/A Plasmid: pcDNA-human STING-HA This paper N/A Plasmid: pcDNA-human STING-Myc This paper N/A Plasmid: pcDNA-HA-human IRF3 This paper N/A Plasmid: pGL3-Basic Promega Cat#: E1751 Plasmid: pGL3-IFN-b gene promoter This paper N/A Plasmid: pRL-TK Promega Cat#: E2241 Software and algorithms GraphPad Prism 8 GraphPad N/A ImageJ Schneider et al.48 https://imagej.nih.gov/ij/ STAR (v2.6.1) Dobin et al.49 N/A (Continued on next page) Cell Reports 42, 112508, May 30, 2023 17

    Article Title: Human papillomavirus E5 suppresses immunity via inhibition of the immunoproteasome and STING pathway.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER DESeq2 (v2_1.6.3) Love et al.50 N/A Gene Ontology Ashburner et al.51; Gene Ontology Consortium52; Mi et al.53 http://geneontology.org/ Reactome Fabregat et al.54 https://reactome.org/ KEGG Kanehisa et al.55–57 http://www.kegg.jp/ PEAKS Bioinformatics Solutions Inc. N/A Immune Epitope Database and Analysis Resource (IEDB) Vita et al.58 https://www.iedb.org WebLogo 3 Schneider et al.59; Crooks et al.60 https://weblogo.threeplusone.com Other MycoAlert PLUSMycoplasma Detection Kit Lonza Cat#: LT07-710



    Similar Products

    93
    Novus Biologicals retroviral plasmid pcl 10a1
    Retroviral Plasmid Pcl 10a1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nbp2+29542+plasmid/pCL-10A1+Retrovirus+Packaging+Vector/pmc12270665-279-9-12
    Average 93 stars, based on 1 article reviews
    retroviral plasmid pcl 10a1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Novus Biologicals retroviral plasmid pdon ai
    Retroviral Plasmid Pdon Ai, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nbp2+29542+plasmid/pCL-10A1+Retrovirus+Packaging+Vector/pmc11447824__GTC___29___290___s001-10-13-23
    Average 93 stars, based on 1 article reviews
    retroviral plasmid pdon ai - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Novus Biologicals nbp2 29542 plasmid
    Nbp2 29542 Plasmid, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nbp2+29542+plasmid/pCL-10A1+Retrovirus+Packaging+Vector/pm38100351-247-90-93
    Average 93 stars, based on 1 article reviews
    nbp2 29542 plasmid - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    91
    Addgene inc nbp2 29542 plasmid
    Nbp2 29542 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nbp2+29542+plasmid/pCDF1-ERBB4+(E836K)+(Plasmid+%2329542)/pm38100351-247-90-102
    Average 91 stars, based on 1 article reviews
    nbp2 29542 plasmid - by Bioz Stars, 2026-09
    91/100 stars
      Buy from Supplier

    93
    Novus Biologicals packaging plasmid pcl 10a1
    Packaging Plasmid Pcl 10a1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nbp2+29542+plasmid/pCL-10A1+Retrovirus+Packaging+Vector/pm37046091-389-11-14
    Average 93 stars, based on 1 article reviews
    packaging plasmid pcl 10a1 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results